View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2631_high_20 (Length: 238)
Name: NF2631_high_20
Description: NF2631
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2631_high_20 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 139; Significance: 7e-73; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 139; E-Value: 7e-73
Query Start/End: Original strand, 1 - 143
Target Start/End: Original strand, 30587445 - 30587587
Alignment:
| Q |
1 |
ttcttaaatcacgtagacgtaagggtgaataaaatggacccacaaataaatgcaagtaggaaggaaatacaacatgaatttcattttcccaccacaaaca |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30587445 |
ttcttaaatcacgtagacgtaagggtgaataaaatggacccacaaataaatgcaagtaggaaggaaatacaacatgaatttcattttcccaccacaaaca |
30587544 |
T |
|
| Q |
101 |
cttcttagaggctgctggtgtggtgtgaattttaaaattttga |
143 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
30587545 |
cttcttagaggctgctggtgtggtgtgaattttaaaatcttga |
30587587 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 185 - 222
Target Start/End: Original strand, 30587570 - 30587607
Alignment:
| Q |
185 |
tgaattttaaaatcttgataaactagggaggaaaaaga |
222 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30587570 |
tgaattttaaaatcttgataaactagggaggaaaaaga |
30587607 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University