View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2631_low_15 (Length: 254)
Name: NF2631_low_15
Description: NF2631
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2631_low_15 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 134; Significance: 7e-70; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 134; E-Value: 7e-70
Query Start/End: Original strand, 1 - 230
Target Start/End: Original strand, 30409850 - 30410077
Alignment:
| Q |
1 |
catatcttatattgcattttctttgaccattatttttcaaagatcaatgtaacaatgattattattttttaaagaaatactaacaggtgtctatgagaca |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||| |||||||||||||||||||||||||||||||||||||||| |||||| ||| ||| |
|
|
| T |
30409850 |
catatcttatattgcattttctttgaccatcatttttcaaagattaatgtaacaatgattattattttttaaagaaatactaacaagtgtctttgaaaca |
30409949 |
T |
 |
| Q |
101 |
tttttaatgaatcaaaattaaaggagaannnnnnnnatataaaataatgtaatcatatattcaaaaagtatttgacatgtatttttaagatagaannnnn |
200 |
Q |
| |
|
||||||||||||| ||||||||||||| ||||||||||||||||||||||||| ||||||||||||| ||||||||||||||||||| |
|
|
| T |
30409950 |
tttttaatgaatcgaaattaaaggagatttttttttatataaaataatgtaatcatatatt-aaaaagtatttgatatgtatttttaagatagaattttt |
30410048 |
T |
 |
| Q |
201 |
nnnatacatatctcaatttatgttcataga |
230 |
Q |
| |
|
||||||||| ||||||||||||||||| |
|
|
| T |
30410049 |
tgtatacatatc-caatttatgttcataga |
30410077 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University