View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2631_low_20 (Length: 240)
Name: NF2631_low_20
Description: NF2631
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2631_low_20 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 140; Significance: 2e-73; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 140; E-Value: 2e-73
Query Start/End: Original strand, 1 - 222
Target Start/End: Original strand, 27373845 - 27374050
Alignment:
| Q |
1 |
acatatttgttatactgtgacacaaactctaaactgcttttaaaatccactttttatcatatcatagaactgtttttgggtatatatgaagnnnnnnngc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| || |
|
|
| T |
27373845 |
acatatttgttatactgtgacacaaactctaaactgcttttaaaatccactttttatcatatcatagaaccgtttttgggtatatatgaagaaaaaaagc |
27373944 |
T |
 |
| Q |
101 |
ttaggatgattttatagttaatgattttatagttaacttttgcaacaatagtattggcttctgggtaatgctattgtaaagacgttgtagatgttgagaa |
200 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27373945 |
ttaggatgattttatagttaa----------------ctttgcaacaatagtattggcttctgggtaatgctattgtaaagacgttgtagatgttgagaa |
27374028 |
T |
 |
| Q |
201 |
tatcttttgttttgacatatgt |
222 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
27374029 |
tatcttttgttttgacatatgt |
27374050 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University