View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2631_low_23 (Length: 238)
Name: NF2631_low_23
Description: NF2631
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2631_low_23 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 178; Significance: 4e-96; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 178; E-Value: 4e-96
Query Start/End: Original strand, 18 - 199
Target Start/End: Complemental strand, 44093414 - 44093233
Alignment:
| Q |
18 |
atccccaatgtggccatgtagacggacaaaacgagcagatttcacatttgaaggataccgctggcagccagaaaattgtgatgtgccagagtttgtttga |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44093414 |
atccccaatgtggccatgtagacggacaaaacgagcagatttcacatttgaaggataccgctggcagccagaaaattgtgatgtgccagagtttgtttga |
44093315 |
T |
 |
| Q |
118 |
cccatctgggttcttgaggaagtaggtataatcctttgttcttcatttaatcatgtatgtagttgttacgtttattcactga |
199 |
Q |
| |
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44093314 |
cgcatctgggttcttgaggaagtaggtataatcctttgttcttcatttaatcatgtatgtagttgttacgtttattcactga |
44093233 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 43; Significance: 0.000000000000001; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 23 - 154
Target Start/End: Complemental strand, 39279169 - 39279042
Alignment:
| Q |
23 |
caatgtggccatgtagacggacaaaacgagcagatttcacatttgaaggataccgctggcagccagaaaattgtgatgtgccagagtttgtttgacccat |
122 |
Q |
| |
|
|||||||| |||||||| |||| ||||| || |||| ||||||| |||||||||||||||||| | ||||||||| ||| ||| |||||||| || |
|
|
| T |
39279169 |
caatgtggtcatgtagaatgacacaacgaccaaatttttcatttgagggataccgctggcagccaaagaattgtgatatgcaaga----gtttgaccgat |
39279074 |
T |
 |
| Q |
123 |
ctgggttcttgaggaagtaggtataatccttt |
154 |
Q |
| |
|
|| ||||||||| ||||||||||||| |||| |
|
|
| T |
39279073 |
ctaagttcttgagaaagtaggtataattcttt |
39279042 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University