View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2631_low_24 (Length: 235)
Name: NF2631_low_24
Description: NF2631
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2631_low_24 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 146; Significance: 5e-77; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 146; E-Value: 5e-77
Query Start/End: Original strand, 67 - 220
Target Start/End: Original strand, 12000149 - 12000302
Alignment:
| Q |
67 |
taataaagtatctaaacttgtcaataaacatgaaccattatagaatatctaaactaaatacaaactttttagtttaagaaaccgtttaaaaaattatctt |
166 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
12000149 |
taataaagtatctaaacttgtcaataaacatgaaccattatagaatatctaaactaaatacaaactttttagtttaagaaaccgtttaaaaaattctctt |
12000248 |
T |
|
| Q |
167 |
tactcaatagtccaggcaacatagctaataaaaacaaatattcagtgaaatatt |
220 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
12000249 |
tactcaatagtccaggcaacatagctaataaaaacaaatattcggtgaaatatt |
12000302 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University