View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2631_low_27 (Length: 205)
Name: NF2631_low_27
Description: NF2631
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2631_low_27 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 85; Significance: 1e-40; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 85; E-Value: 1e-40
Query Start/End: Original strand, 19 - 158
Target Start/End: Original strand, 6207858 - 6207999
Alignment:
| Q |
19 |
aataggttagtgttcaaagtgaaagattcatagattattacatgaataagaccatgtt------tttgagacactatgtttcttccataaatgtggtctt |
112 |
Q |
| |
|
|||||| |||||||||||||||||||||||||| |||||||||||| ||||||||| ||||||| |||||||||||||||||||||||||||| |
|
|
| T |
6207858 |
aataggctagtgttcaaagtgaaagattcataggttattacatgaa---gaccatgtttttgtttttgagagactatgtttcttccataaatgtggtctt |
6207954 |
T |
|
| Q |
113 |
ctctatgtaattgtcttgttttttcactttgcaaccctagcacatc |
158 |
Q |
| |
|
|||||||||||||||||| |||||||||||||| |||||||||||| |
|
|
| T |
6207955 |
ctctatgtaattgtcttg-tttttcactttgcatccctagcacatc |
6207999 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University