View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF2631_low_28 (Length: 203)

Name: NF2631_low_28
Description: NF2631
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF2631_low_28
NF2631_low_28
[»] chr5 (1 HSPs)
chr5 (17-184)||(34103944-34104111)


Alignment Details
Target: chr5 (Bit Score: 156; Significance: 4e-83; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 156; E-Value: 4e-83
Query Start/End: Original strand, 17 - 184
Target Start/End: Original strand, 34103944 - 34104111
Alignment:
17 tgaacagcttggtcagtgctagacttcatgactttttgaaaagtctaatgatgaacttgtgacaaattaagtaatgttgaaactttcccattgcttcaaa 116  Q
    |||||||||||||||||||||||||||| ||||||||||||||||| || ||||||||||||||||||||||||||||||||||||||||||||||||||    
34103944 tgaacagcttggtcagtgctagacttcacgactttttgaaaagtctcataatgaacttgtgacaaattaagtaatgttgaaactttcccattgcttcaaa 34104043  T
117 aattgcatatgattcccacacataagtttattgcttttgcatcctatgactcgattttttgaagaagt 184  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
34104044 aattgcatatgattcccacacataagtttattgcttttgcatcctatgactcgattttttgaagaagt 34104111  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University