View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2632_low_1 (Length: 321)
Name: NF2632_low_1
Description: NF2632
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2632_low_1 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 188; Significance: 1e-102; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 188; E-Value: 1e-102
Query Start/End: Original strand, 127 - 314
Target Start/End: Complemental strand, 24522554 - 24522367
Alignment:
| Q |
127 |
gagaagaaaatggaaaaggaaaagaaaagagtgtttaatgtgccagctctgctttgcctaggtcagtgtttattcattaattaagtattaaagttatttt |
226 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24522554 |
gagaagaaaatggaaaaggaaaagaaaagagtgtttaatgtgccagctctgctttgcctaggtcagtgtttattcattaattaagtattaaagttatttt |
24522455 |
T |
 |
| Q |
227 |
aaatgtgtatgatggctacatacatatatcctcttcctctctgtaaattgactgatttatttgtcttaccacaacctatcttcatctc |
314 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24522454 |
aaatgtgtatgatggctacatacatatatcctcttcctctctgtaaattgactgatttatttgtcttaccacaacctatcttcatctc |
24522367 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University