View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2632_low_3 (Length: 225)
Name: NF2632_low_3
Description: NF2632
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2632_low_3 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 137; Significance: 1e-71; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 137; E-Value: 1e-71
Query Start/End: Original strand, 1 - 221
Target Start/End: Original strand, 34329901 - 34330118
Alignment:
| Q |
1 |
tgtaaggcactcttacagttgttgttaccactggttgaaacctttgagatttcgttacaacatgattctgtgtttgatcaatgttatttttaatccaatt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
34329901 |
tgtaaggcactcttacagttgttgttaccactggttgaaacctttgagatttcgttacaacatgattctgtgtttgatcaatgttattgttaatccaatt |
34330000 |
T |
|
| Q |
101 |
gttgttcatnnnnnnnnnnnnnnnnnaaattggtgaaggaattttgatattgtttttgggtaattctgttaannnnnnnncattgacttgaactgatttt |
200 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
34330001 |
gttgttcat---tggtggtggtggtgaaattggtgaaggaattttgatattgtttttgggtaattctgttaattttttttcattgacttgaactgatttt |
34330097 |
T |
|
| Q |
201 |
ttacctgtgcagggacatttt |
221 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
34330098 |
ttacctgtgcagggacatttt |
34330118 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University