View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2633_high_2 (Length: 364)
Name: NF2633_high_2
Description: NF2633
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2633_high_2 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 194; Significance: 1e-105; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 194; E-Value: 1e-105
Query Start/End: Original strand, 20 - 224
Target Start/End: Complemental strand, 22422789 - 22422587
Alignment:
| Q |
20 |
gtccactaccttgcttatgaactaagtgttgacatgtgtctccagattgtccatttaaccaaagacaaagtaccacaatcgggcgaactacaacagtgaa |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22422789 |
gtccactaccttgcttatgaactaagtgttgacatgtgtctccagattgtccatttaaccaaagacaaagtaccacaatcgggcgaactacaacagtgaa |
22422690 |
T |
|
| Q |
120 |
tttgtatctaagtaatgcaagttcggtcatatatatataactctcataaagaagatattacaataattcttatatcaaattaactatatgaatacaactt |
219 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22422689 |
tttgtatctaagtaatgcaagttcggtcatata--tataactctcataaagaagatattacaataattcttatatcaaattaactatatgaatacaactt |
22422592 |
T |
|
| Q |
220 |
gatca |
224 |
Q |
| |
|
||||| |
|
|
| T |
22422591 |
gatca |
22422587 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 37; Significance: 0.000000000008; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 247 - 303
Target Start/End: Complemental strand, 27174443 - 27174388
Alignment:
| Q |
247 |
gattgaaggaccaaggttgaaagttactccaatgaggttttttctatctctattaat |
303 |
Q |
| |
|
|||||||||||| ||||||||||||||| |||||| ||||||||||||||| ||||| |
|
|
| T |
27174443 |
gattgaaggaccgaggttgaaagttactgcaatga-gttttttctatctctgttaat |
27174388 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University