View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF2633_low_2 (Length: 364)

Name: NF2633_low_2
Description: NF2633
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF2633_low_2
NF2633_low_2
[»] chr6 (1 HSPs)
chr6 (20-224)||(22422587-22422789)
[»] chr3 (1 HSPs)
chr3 (247-303)||(27174388-27174443)


Alignment Details
Target: chr6 (Bit Score: 194; Significance: 1e-105; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 194; E-Value: 1e-105
Query Start/End: Original strand, 20 - 224
Target Start/End: Complemental strand, 22422789 - 22422587
Alignment:
20 gtccactaccttgcttatgaactaagtgttgacatgtgtctccagattgtccatttaaccaaagacaaagtaccacaatcgggcgaactacaacagtgaa 119  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
22422789 gtccactaccttgcttatgaactaagtgttgacatgtgtctccagattgtccatttaaccaaagacaaagtaccacaatcgggcgaactacaacagtgaa 22422690  T
120 tttgtatctaagtaatgcaagttcggtcatatatatataactctcataaagaagatattacaataattcttatatcaaattaactatatgaatacaactt 219  Q
    |||||||||||||||||||||||||||||||||  |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
22422689 tttgtatctaagtaatgcaagttcggtcatata--tataactctcataaagaagatattacaataattcttatatcaaattaactatatgaatacaactt 22422592  T
220 gatca 224  Q
    |||||    
22422591 gatca 22422587  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 37; Significance: 0.000000000008; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 247 - 303
Target Start/End: Complemental strand, 27174443 - 27174388
Alignment:
247 gattgaaggaccaaggttgaaagttactccaatgaggttttttctatctctattaat 303  Q
    |||||||||||| ||||||||||||||| |||||| ||||||||||||||| |||||    
27174443 gattgaaggaccgaggttgaaagttactgcaatga-gttttttctatctctgttaat 27174388  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University