View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2633_low_4 (Length: 309)
Name: NF2633_low_4
Description: NF2633
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2633_low_4 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 173; Significance: 5e-93; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 173; E-Value: 5e-93
Query Start/End: Original strand, 31 - 293
Target Start/End: Original strand, 7898563 - 7898805
Alignment:
| Q |
31 |
gtaggtggtcttggtggtgttgtttaggagcattagctgtgttggcttaggtgctgatgtttgttagtttttggtagctttttggtggcggcctgccgtt |
130 |
Q |
| |
|
||||||||| ||||||| |||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7898563 |
gtaggtggtattggtggcgttgtttaggagcattagctgtgttggcttaggtgctggtgtttgttagtttttggtagctttttggtggcggcctgccgtt |
7898662 |
T |
 |
| Q |
131 |
ttttctgctgttggttatgagagccaccttgtatcttccattccatgtctctcccttgtatgggtaatgtgaagtgatatcctcctcttgtcaatgcctt |
230 |
Q |
| |
|
|||||||||||||||||||| |||||||| |||||||||||||||||||||||||||||| |||||||||||||| |||||| |
|
|
| T |
7898663 |
ttttctgctgttggttatgacagccacct----------------tgtctctcccttgtatgggtaatgtgaagtaatatcctcctcttg----tgcctt |
7898742 |
T |
 |
| Q |
231 |
caagttcaatggtgatgagtcttatatatgtaatgtaggcatttcagcttgtggcagacttat |
293 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7898743 |
caagttcaatggtgatgagtcttatatatgtaatgtaggcatttcagcttgtggcagacttat |
7898805 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University