View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2633_low_6 (Length: 248)
Name: NF2633_low_6
Description: NF2633
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2633_low_6 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 217; Significance: 1e-119; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 217; E-Value: 1e-119
Query Start/End: Original strand, 1 - 237
Target Start/End: Complemental strand, 15951305 - 15951069
Alignment:
| Q |
1 |
cgcttcaactaaaaagggaaatccgcagtctttacctaggaggcaagttacttctagtgtggagaacaaaaaagttgcgaccagatctttgcacttgtct |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
15951305 |
cgcttcaactaaaaagggaaatccgcagtctttacctaggagacaagttacttctagtgtggagaacaaaaaagctgcgaccagatctttgcacttgtcg |
15951206 |
T |
|
| Q |
101 |
atgagcttaggtccaagtaatcctgagccagttcctcatactactgatccagttcctcgtactatgaggaaatctctcattatggatagtatgggggata |
200 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15951205 |
atgagcttaggtccaagtaatcctgaaccagttcctcatactactgatccagttcctcatactatgaggaaatctctcattatggatagtatgggggata |
15951106 |
T |
|
| Q |
201 |
aggacatagtcaaacgagcatttaagactttccagaa |
237 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15951105 |
aggacatagtcaaacgagcatttaagactttccagaa |
15951069 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University