View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2635_low_10 (Length: 256)
Name: NF2635_low_10
Description: NF2635
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2635_low_10 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 192; Significance: 1e-104; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 192; E-Value: 1e-104
Query Start/End: Original strand, 18 - 232
Target Start/End: Complemental strand, 44525831 - 44525616
Alignment:
| Q |
18 |
caaagttacattaacattttttgtcaaataattggaagggttcaaaaatttatttggaagctttatcatagtaaacttcttataacgtaagaaacgtcaa |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |||||||||| ||||||||| |||| |
|
|
| T |
44525831 |
caaagttacattaacattttttgtcaaataattggaagggttcaaaaatttatttggaagctttatcatggtaagcttcttataatgtaagaaacatcaa |
44525732 |
T |
|
| Q |
118 |
agtatctatgatttggatacttgcttcagatgtttctgagaaccagaaatcatatgatgcatgtttttgcgagg-ttgtaatgtagctaaggagctatgg |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
44525731 |
agtatctatgatttggatacttgcttcagatgtttctgagaaccagaaatcatatgatgcatgtttttgcgaggtttgtaatgtagctaaggagctatgg |
44525632 |
T |
|
| Q |
217 |
aaaaactttattacgt |
232 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
44525631 |
aaaaactttattacgt |
44525616 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University