View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2635_low_14 (Length: 247)
Name: NF2635_low_14
Description: NF2635
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2635_low_14 |
 | |
|
| [»] chr4 (2 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 174; Significance: 1e-93; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 174; E-Value: 1e-93
Query Start/End: Original strand, 1 - 247
Target Start/End: Complemental strand, 54425439 - 54425202
Alignment:
| Q |
1 |
gatggttcttccttgaaggcgttgaaccatgatttgcaaacaagcatcgcaccacgccattgatcgtcaaagctgagtcgagataggatattgatgaggc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| || ||| ||||||||||| ||||||||||||||||||||||| |||||||||| |
|
|
| T |
54425439 |
gatggttcttccttgaaggcgttgaaccatgatttgcaaacaagcaacgaaccgcgccattgatcttcaaagctgagtcgagataggatgttgatgaggc |
54425340 |
T |
|
| Q |
101 |
actcacgagtcaactcgccccactcggcttcgctttcttcttccatttttgttccttctattgtttggatttagacggaactgcgtccctagtaatagat |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| | ||||||||| |
|
|
| T |
54425339 |
actcacgagtcaactcgccccactcggcttcgctttctacttccatttttgttccttctattgtttggatttagacggaactgcgtccattgtaatagat |
54425240 |
T |
|
| Q |
201 |
agatcatttttagactccaatccaacacgtgcgatgcacgggttttt |
247 |
Q |
| |
|
| |||||||||| ||||||||||||||||||||| ||||| |
|
|
| T |
54425239 |
a----atttttagac-----tccaacacgtgcgatgcacggtttttt |
54425202 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 4 - 122
Target Start/End: Original strand, 54430312 - 54430430
Alignment:
| Q |
4 |
ggttcttccttgaaggcgttgaaccatgatttgcaaacaagcatcgcaccacgccattgatcgtcaaagctgagtcgagataggatattgatgaggcact |
103 |
Q |
| |
|
||||||||||| ||||| ||||||||||||| || |||||||| ||||| ||||||||||| |||| | |||||||| | ||| ||||||||||| | |
|
|
| T |
54430312 |
ggttcttccttaaaggcactgaaccatgatttacatacaagcattgcaccgcgccattgatcttcaacggtgagtcgaatgaagatgttgatgaggcaat |
54430411 |
T |
|
| Q |
104 |
cacgagtcaactcgcccca |
122 |
Q |
| |
|
| |||| ||||||||||| |
|
|
| T |
54430412 |
ctcgagataactcgcccca |
54430430 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University