View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF2635_low_17 (Length: 219)

Name: NF2635_low_17
Description: NF2635
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF2635_low_17
NF2635_low_17
[»] chr4 (1 HSPs)
chr4 (81-200)||(36167899-36168019)


Alignment Details
Target: chr4 (Bit Score: 97; Significance: 8e-48; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 97; E-Value: 8e-48
Query Start/End: Original strand, 81 - 200
Target Start/End: Complemental strand, 36168019 - 36167899
Alignment:
81 atagcagaaaccataggttacattaacttcattagaataagttggttgtagctttagtttgataaact-ttttagtataattaaaaatgttgtttagtta 179  Q
    |||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||  |||||||||    
36168019 atagcagaaaccatagattacattaacttcattagaataagttggttgtagctttagtttgataaacttttttagtataattaaaaatgcagtttagtta 36167920  T
180 gagtgatactaaatcatgtct 200  Q
     ||||||||||||||||||||    
36167919 aagtgatactaaatcatgtct 36167899  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University