View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2635_low_4 (Length: 283)
Name: NF2635_low_4
Description: NF2635
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2635_low_4 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 88; Significance: 2e-42; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 88; E-Value: 2e-42
Query Start/End: Original strand, 22 - 132
Target Start/End: Complemental strand, 44525616 - 44525501
Alignment:
| Q |
22 |
ttagtttggcttatcgtaatgtgtgaatttaatctgcaaaggaatgctcccgataataacctatgcctga-----actatagggattgacccatggtttt |
116 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| ||||||||||||||||| |
|
|
| T |
44525616 |
ttaggttggcttatcgtaatgtgtgaatttaatctgcaaaggaatgctcccgataataacctatgcctgaactacactatagagattgacccatggtttt |
44525517 |
T |
|
| Q |
117 |
ttgttcagatgaattc |
132 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
44525516 |
ttgttcagatgaattc |
44525501 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 197 - 277
Target Start/End: Complemental strand, 44525436 - 44525356
Alignment:
| Q |
197 |
cttgatgaatggaacttatatgaaggacaaaatggatcaagatataatgcaaaaaagtgggacccaaataattcatctcac |
277 |
Q |
| |
|
|||| ||||| |||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
44525436 |
cttggtgaatagaacttatatgaaggacaaaatagatcaagatataatgcaaaaaagtgggacccaaataattcatttcac |
44525356 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University