View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF2635_low_9 (Length: 259)

Name: NF2635_low_9
Description: NF2635
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF2635_low_9
NF2635_low_9
[»] chr8 (1 HSPs)
chr8 (15-230)||(30054519-30054736)


Alignment Details
Target: chr8 (Bit Score: 173; Significance: 4e-93; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 173; E-Value: 4e-93
Query Start/End: Original strand, 15 - 230
Target Start/End: Original strand, 30054519 - 30054736
Alignment:
15 agagacagtcaatgatttgatattagaaaactagtagtagccagttgagtaggactgcagattcatcttccaacgggcgatt---gaatccgatgtctgc 111  Q
    |||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |||||||| ||||||||   |||||||||||||||    
30054519 agagacagtcaatgatttgatattagaaaact-gtagtagccagttgagtaggactgcagattcgtcttccaaggggcgattaatgaatccgatgtctgc 30054617  T
112 atccttgtaaacgtgtttaacagaacaaagatggatatggcatggtttttggttgagagatccaataaaagaaaagttggaaagcaaatgagcagatatg 211  Q
    |||| ||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
30054618 atccatgtaaacatgtttaacagaacaaagatggatatggcatggtttttggttgagagatccaataaaagaaaagttggaaagcaaatgagcagatatg 30054717  T
212 ttgcacatcaaactagcat 230  Q
    ||||  |||||||||||||    
30054718 ttgccaatcaaactagcat 30054736  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University