View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2636_low_1 (Length: 333)
Name: NF2636_low_1
Description: NF2636
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2636_low_1 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 172; Significance: 2e-92; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 172; E-Value: 2e-92
Query Start/End: Original strand, 127 - 321
Target Start/End: Original strand, 49192845 - 49193042
Alignment:
| Q |
127 |
ttactgaagtcactgtgttcttgcttatggtgtaaggtgtatgatatggaaggctttatatagatatatgataaaggaagacaatgcatgatagcaaaat |
226 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
49192845 |
ttactgaagtcactgtgttcttgcttatggtgtaaggtgtatggtatggaaggctttatatagatatatgataaaggaagagaatgcatgatagcaaaat |
49192944 |
T |
|
| Q |
227 |
aat---tataattttattggatgaaccattttctacgcacacctctaattggctattaaagattatcgatggttaaacttagtatcttttttgtctct |
321 |
Q |
| |
|
||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
49192945 |
aattagtataattttattggatgaaccattttctacgcacacctctaattggctattaaagattatcgatggttaaacttagtatattttttgtctct |
49193042 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 81; E-Value: 4e-38
Query Start/End: Original strand, 1 - 93
Target Start/End: Original strand, 49192717 - 49192809
Alignment:
| Q |
1 |
gcgagttttatgtctttgattccgattccagttatcacaaggtattgtgatgcttttgctaccttgtacattgttgattttgatttaattttt |
93 |
Q |
| |
|
||||| ||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
49192717 |
gcgagctttatgtctttgattccgattccggttatcacaaggtattgtgatgcttttgctaccttgtacatcgttgattttgatttaattttt |
49192809 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 39; Significance: 0.0000000000005; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 4 - 86
Target Start/End: Original strand, 31528102 - 31528184
Alignment:
| Q |
4 |
agttttatgtctttgattccgattccagttatcacaaggtattgtgatgcttttgctaccttgtacattgttgattttgattt |
86 |
Q |
| |
|
||||| ||||||| ||||||| ||| |||||||| || || | ||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
31528102 |
agtttgatgtcttcgattccggctccggttatcaccagatactcggatgcttttgctaccctgtacattgttgattttgattt |
31528184 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 4 - 86
Target Start/End: Original strand, 51825505 - 51825588
Alignment:
| Q |
4 |
agttttatgtctttgattccgattccagttatcacaaggtattgtgatgcttttgctaccttgtacattgtt-gattttgattt |
86 |
Q |
| |
|
||||| ||||||| ||||||| ||| |||| ||| ||||| | ||||||||||||||| ||||||||||| ||||||||||| |
|
|
| T |
51825505 |
agtttgatgtcttcgattccggctccggttaacaccaggtactcggatgcttttgctaccctgtacattgttggattttgattt |
51825588 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 37; Significance: 0.000000000008; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 2 - 86
Target Start/End: Original strand, 26757360 - 26757444
Alignment:
| Q |
2 |
cgagttttatgtctttgattccgattccagttatcacaaggtattgtgatgcttttgctaccttgtacattgttgattttgattt |
86 |
Q |
| |
|
||||||| ||||||||||| | ||| |||||||||||||||| |||||||||||| ||||| |||||| |||| |||||||| |
|
|
| T |
26757360 |
cgagtttgatgtctttgatccatgctccggttatcacaaggtattctgatgcttttgcgaccttatacattcttgaatttgattt |
26757444 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University