View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2636_low_2_N (Length: 336)
Name: NF2636_low_2_N
Description: NF2636
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2636_low_2_N |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 83; Significance: 3e-39; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 83; E-Value: 3e-39
Query Start/End: Original strand, 1 - 83
Target Start/End: Original strand, 1701926 - 1702008
Alignment:
| Q |
1 |
aggttttgtgacggtggcgaggtgaagaagtgctgttgagttgcagcattgagaaaaaatcggtttcttgttggtcaagaaac |
83 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1701926 |
aggttttgtgacggtggcgaggtgaagaagtgctgttgagttgcagcattgagaaaaaatcggtttcttgttggtcaagaaac |
1702008 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University