View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2636_low_8 (Length: 207)
Name: NF2636_low_8
Description: NF2636
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2636_low_8 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 115; Significance: 1e-58; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 115; E-Value: 1e-58
Query Start/End: Original strand, 1 - 123
Target Start/End: Original strand, 27313085 - 27313207
Alignment:
| Q |
1 |
atcaatctggagaaatgcaaatactatgtcagtaattgtaatgatgagtcgctgataaaactaaataattatttttgtgtatgcatcacctggatgatta |
100 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27313085 |
atcaatctggagaaatgcaaataccatgtcagtaattgtaatgaagagtcgctgataaaactaaataattatttttgtgtatgcatcacctggatgatta |
27313184 |
T |
 |
| Q |
101 |
gattgtctttacaaggccctatg |
123 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
27313185 |
gattgtctttacaaggccctatg |
27313207 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University