View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2637_low_14 (Length: 243)
Name: NF2637_low_14
Description: NF2637
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2637_low_14 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 174; Significance: 1e-93; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 174; E-Value: 1e-93
Query Start/End: Original strand, 1 - 182
Target Start/End: Original strand, 43413029 - 43413210
Alignment:
| Q |
1 |
agaagtaaattggttgctatcccttttatgaagatattttagaaactaattttaaagattcaccttataaattgacggttacacgtgtaaaataacactc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43413029 |
agaagtaaattggttgctatcccttttatgaagatattttagaaactaattttaaagagtcgccttataaattgacggttacacgtgtaaaataacactc |
43413128 |
T |
|
| Q |
101 |
cgtacatcaatttctaacttcaatcatcatacatgttggatattgcatgcactacgtgttttaagtaatgtttatgtttcat |
182 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43413129 |
cgtacatcaatttctaacttcaatcatcatacatgttggatattgcatgcactacgtgttttaagtaatgtttatgtttcat |
43413210 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University