View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2637_low_7 (Length: 292)
Name: NF2637_low_7
Description: NF2637
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2637_low_7 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 245; Significance: 1e-136; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 245; E-Value: 1e-136
Query Start/End: Original strand, 18 - 285
Target Start/End: Original strand, 45659093 - 45659361
Alignment:
| Q |
18 |
tctatgtttatttttggtaagctgaagtataaacaaaaactctttgttggttctgttttttgctgatttgaattt-gatgcaaaatatgttcttgttttt |
116 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| ||||||||||||||| |
|
|
| T |
45659093 |
tctatgtttatttttggtaagctgaagtataaacaaaaactctttgttggttctgttttttgctgatttgaattttgatgcaaactatgttcttgttttt |
45659192 |
T |
|
| Q |
117 |
tgatgtagtattgtcagcattggacaacatgggttttgtggcaaacatggttagcttagttctatatttttatggagtgatgcactttgatataccaagt |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45659193 |
tgatgtagtattgtcagcattggacaacatgggttttgtggcaaacatggttagcttagttctatatttttatggagtgatgcactttgatataccaagt |
45659292 |
T |
|
| Q |
217 |
tctgccaatactctcacaaacttcatgggttcaactttcttgctctctcttgttggtggcttcatctca |
285 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||| ||||| |||||||||||||||||| |
|
|
| T |
45659293 |
tctgcaaatactctcacaaacttcatgggttcaactttcttgctttctctagttggtggcttcatctca |
45659361 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 90; Significance: 2e-43; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 90; E-Value: 2e-43
Query Start/End: Original strand, 120 - 285
Target Start/End: Complemental strand, 37984345 - 37984180
Alignment:
| Q |
120 |
tgtagtattgtcagcattggacaacatgggttttgtggcaaacatggttagcttagttctatatttttatggagtgatgcactttgatataccaagttct |
219 |
Q |
| |
|
|||||| |||||||||||||| ||||||||||||||| |||||||||| |||||||| ||||| ||| ||||||||||||||||||| | |||| ||| |
|
|
| T |
37984345 |
tgtagttttgtcagcattggataacatgggttttgtgacaaacatggtgagcttagtactatactttattggagtgatgcactttgatctttcaagctct |
37984246 |
T |
|
| Q |
220 |
gccaatactctcacaaacttcatgggttcaactttcttgctctctcttgttggtggcttcatctca |
285 |
Q |
| |
|
||||| ||| | ||||| || ||||| |||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
37984245 |
gccaacactttgacaaattttatgggctcaactttcttgctctctcttgttggtgccttcatctca |
37984180 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University