View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2637_low_9 (Length: 280)
Name: NF2637_low_9
Description: NF2637
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2637_low_9 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 218; Significance: 1e-120; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 218; E-Value: 1e-120
Query Start/End: Original strand, 18 - 258
Target Start/End: Complemental strand, 13557068 - 13556819
Alignment:
| Q |
18 |
aaaatatgttgtggatgcgaattcagcgcacatgtctggtttcacgtttgtcataattagtattgtacatcttgctggtggcaaaattccagaaggtata |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13557068 |
aaaatatgttgtggatgcgaattcagcgcacatgtctggtttcacgtttgtcataattagtattgtacatcttgctggtggcaaaattccagaaggtata |
13556969 |
T |
 |
| Q |
118 |
gtttaagttgcattgagctataattatcttaagcac---------ttgtggaaatcaaattttgctaggttaaggtctctagatgaatgcaataaatata |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13556968 |
gtttaagttgcattgagctataattatcttaagcacttgttgaacttgtggaaatcaaattttgctaggttaaggtctctagatgaatgcaataaatata |
13556869 |
T |
 |
| Q |
209 |
actatacaaggttctgatatttaaaatttcaagggtaattgagatctgtg |
258 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13556868 |
actatacaaggttctgatatttaaaatttcaagggtaattgagatctgtg |
13556819 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University