View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2638_high_12 (Length: 269)
Name: NF2638_high_12
Description: NF2638
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2638_high_12 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 242; Significance: 1e-134; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 242; E-Value: 1e-134
Query Start/End: Original strand, 1 - 253
Target Start/End: Original strand, 4067842 - 4068095
Alignment:
| Q |
1 |
agtctatttattttgtcaaagtttagaccaaatacataggaatgagtagtacctcttttgaagttgatttaacaaaattgttgtggtcatggaaagcttt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4067842 |
agtctatttattttgtcaaagtttagaccaaatacataggaatgagtagtacctcttttgaagttgatttaacaaaattgttgtggtcatggaaagcttt |
4067941 |
T |
 |
| Q |
101 |
agagacccgtctttgtttttgttgccttctagatgttgcagcctctcgcattttatcgctggactttttcctgtgagagattttctagacttcagttaca |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4067942 |
agagacccgtctttgtttttgttgccttctagatgtcgcagcctctcgcattttatcgctggactttttcctgtgagagattttctagacttcagttaca |
4068041 |
T |
 |
| Q |
201 |
aaatcatgaagt-aaatgtcgagttttgttggaagctacaatcgggtaaactac |
253 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4068042 |
aaatcatgaagtaaaatgtcgagttttgttggaagctacaatcgggtaaactac |
4068095 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University