View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2638_high_16 (Length: 236)
Name: NF2638_high_16
Description: NF2638
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2638_high_16 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 209; Significance: 1e-114; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 209; E-Value: 1e-114
Query Start/End: Original strand, 14 - 222
Target Start/End: Complemental strand, 2592305 - 2592097
Alignment:
| Q |
14 |
aaaggagaaagtgaattaggtgttcccatatgtgatgagtttggtactagtacttgttcttcacctccaatttgtccttcaacactctcccagctgaaaa |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2592305 |
aaaggagaaagtgaattaggtgttcccatatgtgatgagtttggtactagtacttgttcttcacctccaatttgtccttcaacactctcccagctgaaaa |
2592206 |
T |
 |
| Q |
114 |
taaagctaggacattgttgttgagtttccacccattcattcaactcttcttgtctttgcaattgcaatgactccaatgttaataactctcctccttcctc |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2592205 |
taaagctaggacattgttgttgagtttccacccattcattcaactcttcttgtctttgcaattgcaatgactccaatgttaataactctcctccttcctc |
2592106 |
T |
 |
| Q |
214 |
atccatatt |
222 |
Q |
| |
|
||||||||| |
|
|
| T |
2592105 |
atccatatt |
2592097 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University