View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2638_high_17 (Length: 236)
Name: NF2638_high_17
Description: NF2638
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2638_high_17 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 172; Significance: 1e-92; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 172; E-Value: 1e-92
Query Start/End: Original strand, 16 - 228
Target Start/End: Complemental strand, 45594917 - 45594705
Alignment:
| Q |
16 |
gaatgcatggaagaatattttnnnnnnncagtcataactcataattgtgtgagtaccttcaaatttgttgcaattgtccttgaaaacaactcaatctcaa |
115 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45594917 |
gaatgcatggaagaatattttaaaaaaacagtcataactcataattgtgtgagtaccttaaaatttgttgcaattgtccttgaaaacaactcaatctcaa |
45594818 |
T |
|
| Q |
116 |
tcccgtcttaaataaacctggtcgtagttgacttgtagagcatcgggtttgtgtgtctagggacgatggattagggtctaatgaatgtcccttgctctcc |
215 |
Q |
| |
|
|||||||||||||| ||||||| |||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |||||||||||||| |
|
|
| T |
45594817 |
tcccgtcttaaatagacctggtagtagttgacttgtagagcatcgggtttgtgtgtctagggacgatgggttagggtctaatgaacgtcccttgctctcc |
45594718 |
T |
|
| Q |
216 |
ctgccttgagatt |
228 |
Q |
| |
|
||||||||||||| |
|
|
| T |
45594717 |
ctgccttgagatt |
45594705 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University