View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2638_low_18 (Length: 233)
Name: NF2638_low_18
Description: NF2638
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2638_low_18 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 97; Significance: 8e-48; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 97; E-Value: 8e-48
Query Start/End: Original strand, 20 - 132
Target Start/End: Complemental strand, 31375471 - 31375359
Alignment:
| Q |
20 |
atctgtacctctatggagttcttaactgtgacctaattcatttaaatgaaggcaagatactgcccttttgtggctgctaacagctatgcaataatttgtc |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31375471 |
atctgtacctctatggagttcttaactgtgacctaattcatttaaatgaaaacaagatactgcccttttgtggctgctaacagctatgcaataatttgtc |
31375372 |
T |
|
| Q |
120 |
aaaatgaaaacaa |
132 |
Q |
| |
|
||| | ||||||| |
|
|
| T |
31375371 |
aaattaaaaacaa |
31375359 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 141 - 185
Target Start/End: Original strand, 46098227 - 46098271
Alignment:
| Q |
141 |
cagtttgaacttgagtgactaacaatacatttggacccaaatcac |
185 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
46098227 |
cagtttgaacttgagtgactaacaatatgtttggacccaaatcac |
46098271 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University