View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2638_low_3 (Length: 389)
Name: NF2638_low_3
Description: NF2638
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2638_low_3 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 125; Significance: 3e-64; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 125; E-Value: 3e-64
Query Start/End: Original strand, 19 - 151
Target Start/End: Complemental strand, 42334352 - 42334220
Alignment:
| Q |
19 |
attttagtctacatgtccatcaaaggctaattagactgaacttttatcttaacctctattatataaagtagaggtgaccaaatgacgggttgggatgagt |
118 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
42334352 |
attttagtttacatgtccatcaaaggctaattagactgaacttttatcttaacctctattatataaagtagaggtgaccaaatgacgggttgggacgagt |
42334253 |
T |
 |
| Q |
119 |
tatacttgtccttaacccaaccttaaactttta |
151 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
42334252 |
tatacttgtccttaacccaaccttaaactttta |
42334220 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 330 - 375
Target Start/End: Complemental strand, 42334220 - 42334175
Alignment:
| Q |
330 |
aactcaaaacatgattcttacaataatactttactatgagatttct |
375 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42334220 |
aactcaaaacatgattcttacaataatactttactatgagatttct |
42334175 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University