View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2639_high_16 (Length: 393)
Name: NF2639_high_16
Description: NF2639
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2639_high_16 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 128; Significance: 5e-66; HSPs: 5)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 128; E-Value: 5e-66
Query Start/End: Original strand, 16 - 143
Target Start/End: Original strand, 18133719 - 18133846
Alignment:
| Q |
16 |
acatcatctctccccatcatgtacagcaagtcataaatttggttcacagcatgccctgcactagtccagctatttgcactgatggtcactgcctgcagat |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18133719 |
acatcatctctccccatcatgtacagcaagtcataaatttggttcacagcatgccctgcactagtccagctatttgcactgatggtcactgcctgcagat |
18133818 |
T |
 |
| Q |
116 |
taaggaccaaatcaacttaagtagaaat |
143 |
Q |
| |
|
|||||||||||||||||||||||||||| |
|
|
| T |
18133819 |
taaggaccaaatcaacttaagtagaaat |
18133846 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 128; E-Value: 5e-66
Query Start/End: Original strand, 16 - 143
Target Start/End: Original strand, 49120929 - 49121056
Alignment:
| Q |
16 |
acatcatctctccccatcatgtacagcaagtcataaatttggttcacagcatgccctgcactagtccagctatttgcactgatggtcactgcctgcagat |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49120929 |
acatcatctctccccatcatgtacagcaagtcataaatttggttcacagcatgccctgcactagtccagctatttgcactgatggtcactgcctgcagat |
49121028 |
T |
 |
| Q |
116 |
taaggaccaaatcaacttaagtagaaat |
143 |
Q |
| |
|
|||||||||||||||||||||||||||| |
|
|
| T |
49121029 |
taaggaccaaatcaacttaagtagaaat |
49121056 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 97; E-Value: 1e-47
Query Start/End: Original strand, 186 - 290
Target Start/End: Original strand, 49121055 - 49121159
Alignment:
| Q |
186 |
attttttccggggaaatcgtactatttttcttttacttcaaaaaatatgcaaattaattagttatatctacactatatatggttttgggatgatttttca |
285 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
49121055 |
attttttccggggaaatcgtactatttttcttttgcttcaaaaaatatgcaaattaattagttatatctacactatatatggttttgggatgatttttta |
49121154 |
T |
 |
| Q |
286 |
ctttc |
290 |
Q |
| |
|
||||| |
|
|
| T |
49121155 |
ctttc |
49121159 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #4
Raw Score: 90; E-Value: 2e-43
Query Start/End: Original strand, 186 - 290
Target Start/End: Original strand, 18133845 - 18133950
Alignment:
| Q |
186 |
attttttccggggaaatcgtactatttttcttttacttcaaaaaata-tgcaaattaattagttatatctacactatatatggttttgggatgatttttc |
284 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18133845 |
attttttccggggaaatcgtactatttttcttttgcttcaaaaaataatgcaaattaattagttatatctacactatatatggttttgggatgatttttt |
18133944 |
T |
 |
| Q |
285 |
actttc |
290 |
Q |
| |
|
|||||| |
|
|
| T |
18133945 |
actttc |
18133950 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #5
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 18 - 112
Target Start/End: Original strand, 49105032 - 49105126
Alignment:
| Q |
18 |
atcatctctccccatcatgtacagcaagtcataaatttggttcacagcatgccctgcactagtccagctatttgcactgatggtcactgcctgca |
112 |
Q |
| |
|
||||||||||||||||||||| || ||||||||||||||||| ||| |||| ||||||||| |||| |||| ||| |||||||||||||||||| |
|
|
| T |
49105032 |
atcatctctccccatcatgtaaagtaagtcataaatttggttaacaacatgacctgcactactccatgtattggcattgatggtcactgcctgca |
49105126 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University