View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2639_high_25 (Length: 265)
Name: NF2639_high_25
Description: NF2639
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2639_high_25 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 181; Significance: 7e-98; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 181; E-Value: 7e-98
Query Start/End: Original strand, 11 - 246
Target Start/End: Original strand, 3857936 - 3858172
Alignment:
| Q |
11 |
cgaagaatataaattgttgactaaacaaaaaccaattaattatgatgccannnnnnnng-gtacaaattatgatgccatttcacacacacaaatgtttgt |
109 |
Q |
| |
|
|||| ||||| ||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| | |||||||||||||||| |
|
|
| T |
3857936 |
cgaaaaatattaattgttgactaaacaaaaaccaattaattatgatgccattttttttttgtacaaattatgatgccattttagacacacaaatgtttgt |
3858035 |
T |
 |
| Q |
110 |
acatctttgtgagatttatattgaatgtattaaggttttttgaattaaggaaaattgaagagaagatatcaaagtagaatggagaaatacaaggttgcaa |
209 |
Q |
| |
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3858036 |
atatctttgtgagatttatattgaatgtattaaggttttttgaattaaggaaaattgaagagaagatatcaaagtagaatggagaaatacaaggttgcaa |
3858135 |
T |
 |
| Q |
210 |
ttatgttgctttgggcattttttgttgcaggagcaat |
246 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3858136 |
ttatgttgctttgggcattttttgttgcaggagcaat |
3858172 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University