View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2639_high_31 (Length: 213)
Name: NF2639_high_31
Description: NF2639
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2639_high_31 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 55; Significance: 9e-23; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 55; E-Value: 9e-23
Query Start/End: Original strand, 16 - 98
Target Start/End: Complemental strand, 7535100 - 7535018
Alignment:
| Q |
16 |
atacttgagcactaaattatgatatgaaaatggagaaggannnnnnnngtgatgaaaatgacaaggttagtgattatttatag |
98 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |||||||||||||||||| |
|
|
| T |
7535100 |
atacttgagcactaaattatgatatgaaaatggagaaggattttttttgtgatgaaaatgacaatgttagtgattatttatag |
7535018 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 162 - 200
Target Start/End: Complemental strand, 7534955 - 7534917
Alignment:
| Q |
162 |
agtgatactcttgttaccgttactcatcaaagtaattta |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7534955 |
agtgatactcttgttaccgttactcatcaaagtaattta |
7534917 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University