View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2639_low_29 (Length: 247)
Name: NF2639_low_29
Description: NF2639
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2639_low_29 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 57; Significance: 6e-24; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 57; E-Value: 6e-24
Query Start/End: Original strand, 80 - 152
Target Start/End: Complemental strand, 6689217 - 6689145
Alignment:
| Q |
80 |
tgctaccattggtaaagtgatttgcgcgctagcctaatcgtcaatgcaggtcgtgtatcaacattgttccata |
152 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||||||||||||| |||||||||||| ||| |||| |
|
|
| T |
6689217 |
tgctaccattggtaaagtgatttgcgcgccagcctaatcgtcaatgcaggttgtgtatcaacatcgtttcata |
6689145 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 57; E-Value: 6e-24
Query Start/End: Original strand, 21 - 89
Target Start/End: Complemental strand, 6690490 - 6690423
Alignment:
| Q |
21 |
tacggtgttgttgcccgagcctggaacattaatcatatgttagctgcttcaaacacacatgctaccatt |
89 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
6690490 |
tacggtgttgttgcccgagcctggaacattactcatatgtt-gctgcttcaaacacacatgctaccatt |
6690423 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University