View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2640-Insertion-8 (Length: 749)
Name: NF2640-Insertion-8
Description: NF2640
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2640-Insertion-8 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 89; Significance: 2e-42; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 89; E-Value: 2e-42
Query Start/End: Original strand, 527 - 650
Target Start/End: Original strand, 6476316 - 6476440
Alignment:
| Q |
527 |
tctccctctaactctttccttt-ctctttcggtgcttctccttctatcatcctctctatcaatttgaaaccctaaccctaaaattcttcttcttccactt |
625 |
Q |
| |
|
|||||||||||||||||||||| |||| ||| |||||||||||||||| || ||||||||||||||||| |||||||| ||||||| ||||||||||||| |
|
|
| T |
6476316 |
tctccctctaactctttccttttctctctcgatgcttctccttctatcttcttctctatcaatttgaaatcctaaccccaaaattcgtcttcttccactt |
6476415 |
T |
 |
| Q |
626 |
caatcttcatgatttaagttccttc |
650 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
6476416 |
caatcttcatgatttaagttccttc |
6476440 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 44; E-Value: 0.000000000000001
Query Start/End: Original strand, 674 - 741
Target Start/End: Original strand, 6476438 - 6476505
Alignment:
| Q |
674 |
ttctaaaccttcaattgcatgtgaattttctaggattttggtttggaatggtgaagtatgggggttat |
741 |
Q |
| |
|
|||||||||||||||||| ||||||||| || | ||||||||||||||||||| ||||||| |||||| |
|
|
| T |
6476438 |
ttctaaaccttcaattgcgtgtgaatttcctcgaattttggtttggaatggtggagtatggtggttat |
6476505 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 37; Significance: 0.00000000002; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 169 - 229
Target Start/End: Original strand, 22604891 - 22604950
Alignment:
| Q |
169 |
gaaggagtttaaacaaataatataagacatggtttattttccattatttacttacaagttt |
229 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||| ||| |||||| |||||||| |
|
|
| T |
22604891 |
gaaggagtttaaacaaataatataagacatggtttagattcaatt-tttactcacaagttt |
22604950 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University