View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2640R-Insertion-11 (Length: 320)
Name: NF2640R-Insertion-11
Description: NF2640R
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2640R-Insertion-11 |
 | |
|
| [»] chr8 (2 HSPs) |
| |
|
Alignment Details
Target: chr8 (Bit Score: 131; Significance: 6e-68; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 131; E-Value: 6e-68
Query Start/End: Original strand, 170 - 320
Target Start/End: Original strand, 4440325 - 4440475
Alignment:
| Q |
170 |
attaaaattccctcacttttaagcatccttgtccctatagatgataagaattgctcttgagtagaccttagtaaactcccatgcaagatctgtgacatga |
269 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||| ||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
4440325 |
attaaaattccctctcttttaagcatccttgtccctaaagatgataagaattgctcttgagtagatcttagtaaactcccatgcaagatctgtgacatga |
4440424 |
T |
|
| Q |
270 |
acgaccacaaacacatcaatactagcagaaaacttctatgttccacactgc |
320 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||| ||||||||| |
|
|
| T |
4440425 |
acgaccacaaacacatcaatattagcagaaaacttctatgtaccacactgc |
4440475 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 9 - 85
Target Start/End: Original strand, 4440164 - 4440240
Alignment:
| Q |
9 |
agttttaaagagaatgatataattgttgaaatgttatattgcaaatgaggcactcagtctaatttaaatacaaccct |
85 |
Q |
| |
|
||||||| ||||||| | |||||||||||||||||| |||||||||||||||||| ||| ||||||||||||||||| |
|
|
| T |
4440164 |
agttttagagagaatcagataattgttgaaatgttagattgcaaatgaggcactcggtcaaatttaaatacaaccct |
4440240 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University