View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2640R-Insertion-12 (Length: 151)
Name: NF2640R-Insertion-12
Description: NF2640R
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2640R-Insertion-12 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 139; Significance: 4e-73; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 139; E-Value: 4e-73
Query Start/End: Original strand, 9 - 151
Target Start/End: Original strand, 49694131 - 49694273
Alignment:
| Q |
9 |
cgagagaggaagatgaagaaggacatgctagttctccgatgttgggaaacatgggtctttttcggtctgatgataccggtttaaataacccggtttggac |
108 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49694131 |
cgagagaggaagatgaagaaggacatgctagttctccgatgttgggaaacatgggtctttttcggtctgatgataccggtttaaataacccggtttggac |
49694230 |
T |
 |
| Q |
109 |
cggttttcgttgtaggtctttgctgaaaaggaaagcttggcgc |
151 |
Q |
| |
|
|| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49694231 |
cgcttttcgttgtaggtctttgctgaaaaggaaagcttggcgc |
49694273 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University