View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2640_high_22 (Length: 428)
Name: NF2640_high_22
Description: NF2640
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2640_high_22 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 194; Significance: 1e-105; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 194; E-Value: 1e-105
Query Start/End: Original strand, 220 - 413
Target Start/End: Original strand, 31536202 - 31536395
Alignment:
| Q |
220 |
aggtgctggctttaacttggtacctatgttgaagaaagcacgaactcttcccatgtttgaggttggtttgcagagacttgtgccgaaaaaatgtgacatg |
319 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31536202 |
aggtgctggctttaacttggtacctatgttgaagaaagcacgaactcttcccatgtttgaggttggtttgcagagacttgtgccgaaaaaatgtgacatg |
31536301 |
T |
|
| Q |
320 |
gtggcggcggttgcggtggttgccatggtggctggctttgtttggatttaggaacaaggtatgtcggagggacaaagtgggaaatgaattatat |
413 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31536302 |
gtggcggcggttgcggtggttgccatggtggctggctttgtttggatttaggaacaaggtatgtcggagggacaaagtgggaaatgaattatat |
31536395 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 170; E-Value: 4e-91
Query Start/End: Original strand, 8 - 181
Target Start/End: Original strand, 31535990 - 31536163
Alignment:
| Q |
8 |
ccaagaatatcacctgcaaggttcttagccaagttctggtcaagtgagtcaagatcaaactgcagatactcaacaggtttggctaatcccaatggatcaa |
107 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31535990 |
ccaataatatcacctgcaaggttcttagccaagttctggtcaagtgagtcaagatcaaactgcagatactcaacaggtttggctaatcccaatggatcaa |
31536089 |
T |
|
| Q |
108 |
aaccacggtcaccgatcatcgtcccatcgagccattccggtggctgagcaccaggaaaccacactagcccatca |
181 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31536090 |
aaccacggtcaccgatcatcgtcccatcgagccattccggtggctgagcaccaggaaaccacactagcccatca |
31536163 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University