View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2640_high_27 (Length: 346)
Name: NF2640_high_27
Description: NF2640
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2640_high_27 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 135; Significance: 3e-70; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 135; E-Value: 3e-70
Query Start/End: Original strand, 16 - 329
Target Start/End: Complemental strand, 12871061 - 12870745
Alignment:
| Q |
16 |
actatggcaatggatgagttgcaagttcttgaaaagaatctcgaaatctggatgtatcatgttcgctcaatgaaggt-tgatccaataaacnnnnnnnnn |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| | | ||||||||| |
|
|
| T |
12871061 |
actatggcaatggatgagttgcaagttcttgaaaagaacctcgaaatctggatgtatcatgttcgctcaatgaaggtatcaaccaataaactcttttttt |
12870962 |
T |
 |
| Q |
115 |
nnnctctcttaattagtgggtttattatcttttgtacttattttcatttgagtaaaattatcttatgctgttnnnnnnnnnga-gatttaatatgcctta |
213 |
Q |
| |
|
|||| ||||||||||| |||| |||| ||||||||||||||| || ||||||||||||||| || |||| | || | || ||||||| |
|
|
| T |
12870961 |
---ctcttttaattagtggatttaatatcatttgtacttattttctttagagtaaaattatcttttggtgttaaaaaagaaaaagaataaacgtgcctta |
12870865 |
T |
 |
| Q |
214 |
tacattgaactacagatgaacattatgtcacaagaaatccaaactctgagggataaggttagcataaac----ttattcagcttttatttatttatttag |
309 |
Q |
| |
|
|| ||||||||||||||| |||||||||||||||||||||||| ||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
12870864 |
tattatgaactacagatgaatattatgtcacaagaaatccaaactttgagggataaggttagcataaacttaattattcagcttttatttatttatttag |
12870765 |
T |
 |
| Q |
310 |
ctattacttctttacatatg |
329 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
12870764 |
ctattacttctttacatatg |
12870745 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University