View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2640_high_29 (Length: 298)
Name: NF2640_high_29
Description: NF2640
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2640_high_29 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 262; Significance: 1e-146; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 262; E-Value: 1e-146
Query Start/End: Original strand, 18 - 286
Target Start/End: Complemental strand, 38938262 - 38937993
Alignment:
| Q |
18 |
gtaccattccctatcagctcactaatctctccaaggtaagttaccttgatcttggatcaaacttttt-gtatcttccgttgattggtctcaatattcaaa |
116 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
38938262 |
gtaccattccctatcagctcactaatctctccaaggtaagttaccttgatcttggatcaaacttttttgtatcttccgttgattggtctcaatattcaaa |
38938163 |
T |
 |
| Q |
117 |
catgctttcattaaattaccttggtttggaggaaaatgaattcactggtgacattccaagtttcatacatgagtgcaagaatttaacatatcttgacctc |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38938162 |
catgctttcattaaattaccttggtttggaggaaaatgaattcactggtgacattccaagtttcatacatgagtgcaagaatttaacatatcttgacctc |
38938063 |
T |
 |
| Q |
217 |
tctgagaacagttggaatggtaccataccagaattcctttatggtaatttaggaatgcttgaatatctca |
286 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38938062 |
tctgagaacagttggaatggtaccataccagaattcctttatggtaatttaggaatgcttgaatatctca |
38937993 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University