View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2640_low_43 (Length: 203)
Name: NF2640_low_43
Description: NF2640
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2640_low_43 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 36; Significance: 0.00000000002; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 129 - 172
Target Start/End: Original strand, 864356 - 864399
Alignment:
| Q |
129 |
cattttgcagatttggtctttctattttaaaatttgactgtttt |
172 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||| ||||| |
|
|
| T |
864356 |
cattttgcagatttggtccttctattttaaaatttgacagtttt |
864399 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 35; Significance: 0.00000000007; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 16 - 50
Target Start/End: Complemental strand, 42193154 - 42193120
Alignment:
| Q |
16 |
ataacaaacataaatttcaattaaataccaaaaaa |
50 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
42193154 |
ataacaaacataaatttcaattaaataccaaaaaa |
42193120 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 33; Significance: 0.000000001; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 101 - 174
Target Start/End: Original strand, 38435086 - 38435161
Alignment:
| Q |
101 |
taattgcaattttgat--tcctatttccgtcattttgcagatttggtctttctattttaaaatttgactgttttgg |
174 |
Q |
| |
|
|||||||| ||||||| |||||||||| |||||||| || | |||||| ||||||||||||||||| ||||||| |
|
|
| T |
38435086 |
taattgcagttttgatcctcctatttccatcattttgtggaatcggtcttcctattttaaaatttgacagttttgg |
38435161 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University