View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2641_high_4 (Length: 472)
Name: NF2641_high_4
Description: NF2641
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2641_high_4 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 314; Significance: 1e-177; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 314; E-Value: 1e-177
Query Start/End: Original strand, 102 - 457
Target Start/End: Complemental strand, 2138250 - 2137889
Alignment:
| Q |
102 |
atgtggtgattttgggctatagtaatattccaatggtgaaactggtgaagccataacaacacttcgcatgttgtt------gttgttgttttggaacatc |
195 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
2138250 |
atgtggtgattttgggctatagtaatattccaatggtgaaactggtgaagccataacaacacttcgcatgttgttattgttgttgttgttttggaacatc |
2138151 |
T |
 |
| Q |
196 |
atgggattttccgacacgttgagttggagttttttagaacggcgttcgtggagtttgaagttgggnnnnnnnaagcccattggtggttccatggtggttg |
295 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
2138150 |
atgggattttccgacacgttgagttggagttttttagaacggcgttcgtggagtttgaagttgggtttttttaagcccattggtggttccatggtggttg |
2138051 |
T |
 |
| Q |
296 |
ttggtagaggacggtgggcttgggcttgggcttgggctgttagacgagatgggagtgtgagtgggagtttttgggctgatgggtcttgtgatgctccggt |
395 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2138050 |
ttggtagaggacggtgggcttgggcttgggcttgggctgttagacgagatgggagtgttagtgggagtttttgggctgatgggtcttgtgatgctccggt |
2137951 |
T |
 |
| Q |
396 |
tagtttttgaacaacttgtcggaaatttgatgggtctgcttgtacaaaggttgtgtttggtt |
457 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2137950 |
tagtttttgaacaacttgtcggaaatttgatgggtctgcttgtacaaaggttgtgtttggtt |
2137889 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 58; E-Value: 3e-24
Query Start/End: Original strand, 1 - 58
Target Start/End: Complemental strand, 2138351 - 2138294
Alignment:
| Q |
1 |
ggtaaaagtgcaggtggttgttgctgagaagctctaggagaggggtgcaaatagaaac |
58 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2138351 |
ggtaaaagtgcaggtggttgttgctgagaagctctaggagaggggtgcaaatagaaac |
2138294 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 50; Significance: 2e-19; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 353 - 446
Target Start/End: Original strand, 20016949 - 20017042
Alignment:
| Q |
353 |
tgagtgggagtttttgggctgatgggtcttgtgatgctccggttagtttttgaacaacttgtcggaaatttgatgggtctgcttgtacaaaggt |
446 |
Q |
| |
|
||||||| ||||||||| || || |||||| |||||||||||||||||||| ||||||||||||||||||||||| || |||| ||| ||||| |
|
|
| T |
20016949 |
tgagtggaagtttttggagtgttgagtcttgagatgctccggttagtttttggacaacttgtcggaaatttgatggttcagcttctaccaaggt |
20017042 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University