View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2641_low_11 (Length: 330)
Name: NF2641_low_11
Description: NF2641
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2641_low_11 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 72; Significance: 1e-32; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 72; E-Value: 1e-32
Query Start/End: Original strand, 10 - 85
Target Start/End: Complemental strand, 48313690 - 48313615
Alignment:
| Q |
10 |
tgttgtctgtaatttgcttcgacgaattgctaatcctttacagttttgctatactaacgagtgtaatttccttgat |
85 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
48313690 |
tgttgtctgtaatttgcttcgacgaattgctaatcctttacagttttgctatactaacgagtgtaattttcttgat |
48313615 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University