View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2641_low_14 (Length: 267)
Name: NF2641_low_14
Description: NF2641
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2641_low_14 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 169; Significance: 1e-90; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 169; E-Value: 1e-90
Query Start/End: Original strand, 58 - 254
Target Start/End: Original strand, 19219380 - 19219577
Alignment:
| Q |
58 |
actaagcattttgtattatgatannnnnnn-gtctattataaacattctaatgttttgatatatgatttcagattcatttatgcaaatcaatggcctaag |
156 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19219380 |
actaagcattttgtattatgatattttttttgtctattataaacattctaatgttttgatatatgatttcagattcatttatgcaaatcaatggcctaag |
19219479 |
T |
 |
| Q |
157 |
ttttggaataaactatggacaaatagcaagaaatctaccttctcattcaagagttgctatgcttataagatcaatgaatgtgacaagaatcaaactct |
254 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19219480 |
ttttggaataaactatggacaaatagcaagaaatctaccttctcattcaagagttgctatgcttataagatcaatgaatgtgacaagaatcaaactct |
19219577 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 42; Significance: 0.000000000000006; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 157 - 254
Target Start/End: Original strand, 36381117 - 36381214
Alignment:
| Q |
157 |
ttttggaataaactatggacaaatagcaagaaatctaccttctcattcaagagttgctatgcttataagatcaatgaatgtgacaagaatcaaactct |
254 |
Q |
| |
|
||||||||||||||||||||||||||||| ||| |||| ||||||||| | || || | ||||||| |||| ||||||||| ||||||||||||| |
|
|
| T |
36381117 |
ttttggaataaactatggacaaatagcaaacaatttaccatctcattcacgtgtagcagttcttataaaatcattgaatgtgagcagaatcaaactct |
36381214 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University