View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2641_low_18 (Length: 250)
Name: NF2641_low_18
Description: NF2641
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2641_low_18 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 198; Significance: 1e-108; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 198; E-Value: 1e-108
Query Start/End: Original strand, 21 - 237
Target Start/End: Original strand, 6283947 - 6284164
Alignment:
| Q |
21 |
taggtttggatcttaaaattttgttcagagtaatttttgtttcttt-agcttgcttcgttgaatctgttttgaatttaggctagcccacatagattgtgg |
119 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6283947 |
taggtttggatcttaaaattttgtttagagtaatttttgtttcttttagcttgcttcgttgaatctgttttgaatttaggctagcccacatagattgtgg |
6284046 |
T |
 |
| Q |
120 |
gtagtccgtataactaaataaaaccctaaaatattcgaggtttgagatgttggagaatttagaagttgttttgaacaatttgaaatctataattgtttaa |
219 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
6284047 |
gtagtccgtataactaaataaaaccctaaaatattcgaggtttgagatgttggagaatttaaaagttgttttgaacaatttaaaatctataattgtttaa |
6284146 |
T |
 |
| Q |
220 |
aattttatataatagtat |
237 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
6284147 |
aattttatataatagtat |
6284164 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University