View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2641_low_22 (Length: 238)
Name: NF2641_low_22
Description: NF2641
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2641_low_22 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 186; Significance: 1e-101; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 186; E-Value: 1e-101
Query Start/End: Original strand, 34 - 227
Target Start/End: Original strand, 45644955 - 45645148
Alignment:
| Q |
34 |
acgtccttgaatgtctctctcatcatatataaacacaactaatgtgtgttctacatctaatgtgcaacttttactctttttattcactttacattatact |
133 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45644955 |
acgtccttgaatgtctctctcatcatatataaacacaactaatgtgtgttctatatctaatgtgcaacttttactctttttattcactttacattatact |
45645054 |
T |
|
| Q |
134 |
agttttatcaaataaaggactcaaatgtttattcttccaacttccaatttcaactctagtgtttcaacacatggccatagaaagatggttatct |
227 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
45645055 |
agttttatcaaataaaggactcaaatgtttattcttccaacttccaatttcaactctagtgtttcaacaaatggccatagaaagatggttatct |
45645148 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 178 - 223
Target Start/End: Original strand, 45652828 - 45652873
Alignment:
| Q |
178 |
caatttcaactctagtgtttcaacacatggccatagaaagatggtt |
223 |
Q |
| |
|
|||||||||||||||| | ||||||||||||||| |||||||||| |
|
|
| T |
45652828 |
caatttcaactctagtatcccaacacatggccataaaaagatggtt |
45652873 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University