View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2641_low_23 (Length: 236)
Name: NF2641_low_23
Description: NF2641
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2641_low_23 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 145; Significance: 2e-76; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 145; E-Value: 2e-76
Query Start/End: Original strand, 1 - 229
Target Start/End: Original strand, 32974842 - 32975071
Alignment:
| Q |
1 |
atggagagctgggctcattgtggttcatcagtgaatgttctgaagattcaagtgaggttatgagtgaagaatggtgaagagtgaagatcaagggttcgca |
100 |
Q |
| |
|
||||||| ||||||||||||| |||||||||||||||||||||||||||||||||||| ||||||||||||||||||| ||||||||||||| |||||| |
|
|
| T |
32974842 |
atggagacttgggctcattgtgattcatcagtgaatgttctgaagattcaagtgaggttctgagtgaagaatggtgaagtgtgaagatcaaggattcgca |
32974941 |
T |
 |
| Q |
101 |
cttcgcagtgagtgttctgaagctgcg-nnnnnnnnnnngaagtacacgttcacatttttgaggtgttaatgtattttccttcttaatgtttattattat |
199 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32974942 |
attcgcagtgagtgttctgaagctgcgtttttttttttttaagtacacgttcacgtttttgaggtgttaatgtattttccttcttaatgtttattattat |
32975041 |
T |
 |
| Q |
200 |
attattgatataaaaatataaagagggtct |
229 |
Q |
| |
|
|||||| ||||||||||||| ||||||||| |
|
|
| T |
32975042 |
attattaatataaaaatatagagagggtct |
32975071 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University