View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2642_high_9 (Length: 273)
Name: NF2642_high_9
Description: NF2642
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2642_high_9 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 241; Significance: 1e-133; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 241; E-Value: 1e-133
Query Start/End: Original strand, 17 - 265
Target Start/End: Original strand, 30953032 - 30953280
Alignment:
| Q |
17 |
atatctatatcaaacataatgttaaacccagaaattggggttatgggtcaaaatttctcaatgatgcaaaattgaaattgagagggagagaacatacagt |
116 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30953032 |
atatatatatcaaacataatgttaaacccagaaattggggttatgggtcaaaatttctcaatgatgcaaaattgaaattgagagggagagaacatacagt |
30953131 |
T |
|
| Q |
117 |
ataagaattggggctatgggtcaaattttcgtaatgatgcaaaactgaaattgaagcaaagtagtacacaagaaataaagtatgagaatttatgcgttgt |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30953132 |
ataagaattggggctatgggtcaaattttcgtaatgatgcaaaactgaaattgaagcaaagtagtacacaagaaataaagtatgagaatttatgcgttgt |
30953231 |
T |
|
| Q |
217 |
tgttattgtttgttgtctcaatgaaatttttatgagttttattcatctc |
265 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
30953232 |
tgttattgtttgttgtctcaatgaaatttttatgagttttattcttctc |
30953280 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University