View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2643-Insertion-5 (Length: 119)
Name: NF2643-Insertion-5
Description: NF2643
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2643-Insertion-5 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 88; Significance: 9e-43; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 88; E-Value: 9e-43
Query Start/End: Original strand, 8 - 118
Target Start/End: Original strand, 43714901 - 43715009
Alignment:
| Q |
8 |
tcagcttcatccccaccttcagcatcagctcccatttccctgtcagaaccactttcatcctcatcttcatcatcagtacttgaaagctgtccatttcatc |
107 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||||||||||| |
|
|
| T |
43714901 |
tcagcttcatccccaccttcagcatcagctcccatttccctgtcagaaccactttcatcctcatcatcatcatcagt--ttgaaagctgtccatttcatc |
43714998 |
T |
|
| Q |
108 |
gtcatcatctt |
118 |
Q |
| |
|
||||| |||| |
|
|
| T |
43714999 |
ttcatcctctt |
43715009 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 77; Significance: 3e-36; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 77; E-Value: 3e-36
Query Start/End: Original strand, 8 - 115
Target Start/End: Complemental strand, 52892826 - 52892721
Alignment:
| Q |
8 |
tcagcttcatccccaccttcagcatcagctcccatttccctgtcagaaccactttcatcctcatcttcatcatcagtacttgaaagctgtccatttcatc |
107 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |||||||| |||||| ||||| |
|
|
| T |
52892826 |
tcagcttcatccccatcttcagcatcagctcccatttccctgtcagaaccactgtcatcctcatcttcatcatcagt--ttgaaagccgtccatatcatc |
52892729 |
T |
|
| Q |
108 |
gtcatcat |
115 |
Q |
| |
|
||| |||| |
|
|
| T |
52892728 |
gtcgtcat |
52892721 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University