View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2643R-Insertion-16 (Length: 69)
Name: NF2643R-Insertion-16
Description: NF2643R
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2643R-Insertion-16 |
 |  |
|
| [»] chr6 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 59; Significance: 9e-26; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 59; E-Value: 9e-26
Query Start/End: Original strand, 7 - 69
Target Start/End: Complemental strand, 1666531 - 1666469
Alignment:
| Q |
7 |
cagtcatgtcatgaggatttgaagcttcgatacgagctacaccaaaatcagcgattttcaacg |
69 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1666531 |
cagtcatgtcatgaggattcgaagcttcgatacgagctacaccaaaatcagcgattttcaacg |
1666469 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University