View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2643R-Insertion-17 (Length: 57)
Name: NF2643R-Insertion-17
Description: NF2643R
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2643R-Insertion-17 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
| [»] chr3 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 37; Significance: 0.000000000001; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 37; E-Value: 0.000000000001
Query Start/End: Original strand, 9 - 57
Target Start/End: Complemental strand, 5811480 - 5811432
Alignment:
| Q |
9 |
aaagaaaaactacgtaatgaaatggaaactgaaatcggcccgtgctact |
57 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| || || ||||||| |
|
|
| T |
5811480 |
aaagaaaaactacgtaatgaaatggaaactgaaatgggtccttgctact |
5811432 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 33; Significance: 0.0000000002; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 33; E-Value: 0.0000000002
Query Start/End: Original strand, 9 - 57
Target Start/End: Complemental strand, 27736799 - 27736751
Alignment:
| Q |
9 |
aaagaaaaactacgtaatgaaatggaaactgaaatcggcccgtgctact |
57 |
Q |
| |
|
||||| ||||||||| |||||||||||||| |||| ||||||||||||| |
|
|
| T |
27736799 |
aaagagaaactacgtgatgaaatggaaactaaaataggcccgtgctact |
27736751 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University